Company logo icon

annonome

Decoding the Dark Matter Genome

Arrow down Icon

GGGTCTGTGGCCTTGTGATGAGAAATATGAATTTCGTATTTGCAGCTTGTCAGTACTTT​CAGAATCATGGTCTGCATGGTAAAATGACACTTATTATGAACTTCGACATGGCAATAA​CGCGTCGTATCTACATCATGACAAGAATAGTATAAACAAAACTGCTGTCAGCAGAAGT​GCCAAAGAAGTTTGTAAATTCTTATTTCCGAATAACATCCGTCTCCATGCGGGAAAAT​CACCGACGCCATTTTATAGAAGCCTAGGGAAACAGATTGGTTTAATTAGCTTAAGAGA​GTAAATTCTGGAATTATACAGTAGTAATCATTAATTTACGGTGGAACTTTTATGGCGA​ATTTTTACAGATTCTAACTAGGTGATTTCAACTAATTTTATTGACGATTTAGACGCACT​ATCCCTTAAATTTCAAATTAAAACATAACGTTCCATGAAGGCTAGAATTACTTACCGG​CCTTTACCATACCTACGATATTCGCACCTACTTTCCCATTAATCTGTACAAGTAGATAC​A


Life is governed by a complex, encrypted biological ​code composed of DNA, RNA, and protein sequences. ​Our mission is to decode this intricate biological ​language, advancing our understanding of the ​fundamental mechanisms of life.














At Annonome, we are pioneering BioML syntax to ​understand the 99% “Dark Matter” non-coding genome. ​Unlocking profound insights into disease mechanisms ​for our innovation partners transforming the future of ​medicine in pharmaceuticals and biotechnology.

X Icon
Envelope in a Rounded Square Icon

Platform Access Waitlist: hello@annonome.com

Copyright Symbol Icon

annonome